Spin - SPIN-Align Sequences

Aligning Sequences Globally

This function will produce an optimal global alignment of two segments of the sequence. The dynamic programming alignment algorithm is based on Huang,X On global sequence alignment. CABIOS 10 227-235 (1994). There is no length limit of the sequences but the sequences to be aligned should be of the same type i.e. both be DNA or both protein.

[picture]

A dialogue box (shown above) requests the horizontal and vertical sequences and the ranges over which they are to be aligned ( see section Selecting a sequence) and the gap start penalty and the gap extension penalty. In addition, if the sequence is DNA, the "score for match" and "score for mis-match" must be provided. These values are used to generate a score matrix. For protein sequences, the score matrix can be changed from the "Options" menu ( see section Changing the score matrix).

The alignment is displayed in the Output Window along with the percentage mismatch (see below) and on the SPIN Sequence Comparison Plot as a line. The line represents the path of the alignment.

The following plot shows a global alignment of two Xenopus Laevis sequences. The vertical sequence (xlactcag) is genomic DNA, and the horizontal sequence (xlacacr) is the corresponding cDNA. The vertical sections of the plotted path correspond to introns in the genomic DNA, which are obviously absent from the cDNA.

(Click for full size image)

Below we show a typical alignment (from a different pair of sequences) as produced in the Output Window.

 Percentage mismatch  29.6
                1        11        21        31        41        51
      hsproperd gagcctatcaacccagataaagcgggacctcctctctggtagaggtgcagggggcagtac
                                                                            
       mmproper ************************************************************
             -157      -147      -137      -127      -117      -107

               61        71        81        91       101       111
      hsproperd tcaacatgatcacagagggagcgcaggcccctcgattgttgctgccgccgctgctcctgc
                                                                            
       mmproper ************************************************************
              -97       -87       -77       -67       -57       -47

              121       131       141       151       161       171
      hsproperd tgctcaccctgccagccacaggctcagaccccgtgctctgcttcacccagtatgaagaat
                                                      :: :::::::::::::: :: :
       mmproper **************************************tgtttcacccagtatgaggagt
              -37       -27       -17        -7         3        13

              181       191       201       211       221       231
      hsproperd cctccggcaagtgcaagggcctcctggggggtggtgtcagcgtggaagactgctgtctca
                :::: :::: :::::: ::::: :: ::: : :   :::: :: ::::::::::::::::
       mmproper cctctggcaggtgcaaaggcctacttgggagagacatcagggtagaagactgctgtctca
               23        33        43        53        63        73

The two aligned sequences are automatically saved in memory and can be accessed through the sequence manager. They are assigned default filenames which are based on the parent with the addition of _a"number" where "number" is a unique identifier (see the twelth and thirteenth entries of the sequence manager picture ( see section Sequence manager).

Further operations available for align sequences are:

Information

This command gives a brief description of the sequences used in the comparison and the input parameters used.

horizontal PERSONAL: m13mp18.seq from 1 to 7250
vertical PERSONAL: lawrist7.seq from 1 to 5261

Configure

This option allows the line width and colour of the matches to be altered.See section Colour Selector. A colour browser is displayed from which the desired line width or colour can be configured. Pressing OK will update the SPIN Sequence Comparison Plot.

Display sequences

Selecting this command invokes the Sequence Comparison Display ( see section Sequence Comparison Display). Moving the cursor in the sequence display will move the cursors of the same sequence in any SPIN Sequence Comparison Plot ( see section Cursors). To force the sequence display to show the nearest match, use the "nearest match" button in the sequence display plot.

Hide

This option removes the points from the SPIN Sequence Comparison Plot but retains the information in memory.

Reveal

This option will redisplay previously hidden points in the SPIN Sequence Comparison Plot.

Remove

This command removes all the information regarding this particular invocation of Align sequences, and access to this data is lost.

This page is maintained by staden-package. Last generated on 22 October 2002.
URL: http://www.mrc-lmb.cam.ac.uk/pubseq/manual/spin_unix_37.html