From the Result manager ( see section Result manager), menu a pop-up menu for restriction sites results can be used to write the results in two forms to the the Output window - from here the results can be saved to a file. The two choices of format are "Output enzyme by enzyme" and "Output ordered on position", brief examples of which are shown below. The output also appears in an "Information" window. Note that these listings are also available from gap4.
The restriction enzyme results output ordered "enzyme by enzyme". The enzymes sites are numbered and named and the actual cut site from the sequence is written, followed by the position of the cut, the fragment size, and finally a sorted list of fragment sizes. A list of zero cutters is written underneath.
Matches found= 1 Name Sequence Position Fragment lengths 1 ApaLI G'TGCAC 3506 3505 3505 4629 4629 Matches found= 8 Name Sequence Position Fragment lengths 1 ApoI A'AATTC 1939 1938 184 2 ApoI G'AATTT 2632 693 339 3 ApoI A'AATTT 2996 364 364 4 ApoI G'AATTC 3180 184 419 5 ApoI A'AATTT 5283 2103 639 6 ApoI G'AATTC 5702 419 693 7 ApoI A'AATTC 6341 639 1455 8 ApoI A'AATTC 7796 1455 1938 339 2103 Matches found= 2 Name Sequence Position Fragment lengths 1 AseI AT'TAAT 1790 1789 435 2 AseI AT'TAAT 2225 435 1789 Zero cutters: Acc65I AccIII AclNI AhdI ApaI AscI Asp700I Asp718I AspEI AsuNHI AvrII 5910 5910
The restriction enzyme results output ordered on position. The enzymes sites are numbered and named and the actual cut site from the sequence is written, followed by the position of the cut, the fragment size, and finally a sorted list of cut sizes.
============================================================ Wed 19 Nov 15:42:38 1997: Restriction enzymes result list ------------------------------------------------------------ Sequence /nfs/skye/home10/rs/work/doc/spin/atpase.dat Number of enzymes = 80 Number of matches = 597 Name Sequence Position Fragment lengths 1 AspLEI GCG'C 157 156 0 2 AccII CG'CG 313 156 0 3 AspLEI GCG'C 313 0 0 4 AviII TGC'GCA 322 9 0 5 AspLEI GCG'C 323 1 0 6 AsuHPI 'CGCTTTATCACC 342 19 0 7 AflIII A'CGCGT 362 20 0 8 AccII CG'CG 364 2 0 9 BcgI 'AACAGGGTTAGCAGAAAAGTCG 389 25 0 10 BcgI GCAGAAAAGTCGCAATTGTATGCA' 423 34 0 11 AsuHPI 'CATTTATTCACC 440 17 0 12 AspLEI GCG'C 486 46 0 13 AciI C'CGC 502 16 0 14 AciI G'CGG 552 50 0 15 AccII CG'CG 552 0 0 16 AclI AA'CGTT 614 62 0