The vector_primer files store the data for each vector/primer pair combination as a single record (line) and up to 100 records can be contained in a file. The items on each line must be separated by spaces or tabs (only the file name can contain spaces) and a newline character ends the record.
The items in a record are:
name seq_r seq_f file_name
name is an arbitrary record name. seq_r is the sequence between the reverse primer and the cloning site. seq_f is the sequence between the forward primer and the cloning site. file_name is the name of the file containing the complete vector sequence.
An example file containing two entries (for m13mp18, and a vector called f1) is shown below. "\" symbols have been used to denote wrapped lines and so it can be seen that the first record is shown on two lines and the next on 1.
m13mp18 attacgaattcgagctcggtaccc ggggatcctctagagtcgacctgcaggcatgcaagcttggc \ /pubseq/tables/vectors/m13mp18.seq f1 CCGGGAATTCGCGGCCGCGTCGACT CTAGACTCGAGTTATGCATGCA af_clones_vec
See @xref{Vector_Clip-Vector_Primer-Files,Vector_Clip-Vector_Primer-Files,Vector_Primer files} for information about creating new vector_primer file entries.