first previous next last contents



make_weights -- makes weight matrices from sequence alignments


make_weights [-v] [-m mark position] [-c minimum score] [-C maximum score]

[-w input weight matrix file name] [-o output weight matrix file name] [input aligned sequences file]


make_weights is used to create weight matrix files from a file of aligned sequences. These weight matrices are for use with spin.

The simplest usage is to read in a file of aligned sequence motifs, and write out a weight matrix file created from their observed character frequencies at each position. The only command line input required is the name of the file of aligned sequence and the name for the output weight matrix file. In this mode, make_weights reads in the file of aligned motifs, counts the character frequencies at each position, calculates weights from these, and then applies the weights to all the input sequences, recording the score for each. By default the two cutoff scores written to the weight matrix file will be set to the minimum and maximum scores obtained from this process. In this mode nothing will be written to the output screen.

If no output file is supplied, none is written, but the scores for all the input sequences are written to the screen. In this way the user can decide whether to override the cutoff scores written to the weight matrix file. To set these values they can be supplied on the command line using the -c and -C options.

To see the range of scores for a set of aligned sequences and an existing weight matrix file, the -w option should be used. In this case the matrix file is read, applied to the set of aligned sequences, and the scores are listed on the screen.

The -m option is used to set the mark position and the -v option simply lists the current version number of the program.

The screen output produced by make_weights can be used as input to make_weights. An example is shown below.

Input to make_weights:

HSTGM1A   acagcggaccgtgtgaccat comments
HSARAF1G  aagtctaacagtatctatct 
HSU01337  aagtctaacagtatctatct 
HSA132695 gccgattgccgtatgtaaaa 
HSCEL     ctctctgcaggtctcgggat 

Output from make_weights:

HSTGM1A   acagcggaccgtgtgaccat 0 0.049247 comments
HSARAF1G  aagtctaacagtatctatct 1 0.010509 
HSU01337  aagtctaacagtatctatct 2 0.010509 
HSA132695 gccgattgccgtatgtaaaa 3 0.133783 
HSCEL     ctctctgcaggtctcgggat 4 0.206426 

The output has added two extra columns between the sequences and the comments: a motif number and its score. This file could be passed through a sorting program to shift the lowest scoring motifs to the bottom of the file, and then the records with poor scores investigated, and perhaps removed. On UNIX the following creates a file as shown above, called don.s, and then sorts it on score to create the ordered file

make_weights > don.s
sort -n -r +3 -o don.s

The weights are calculated in the following way.

The algorithm deals with the problem of zero counts by adding a small amount to every element. For alignments with few sequences the effect will be quite marked, but for large datasets it will be very small.

The score for unknown characters found in sequences is set to the mean for the column.

In calculating the log odds it is assumed that probability of each base type in a random sequence is 0.25

Let the counts for each position (column) and character type in the alignment be stored in counts, and put the weights in matrix. Both are two dimensional arrays. Char_set_size is the character set size which is 4 for DNA.

 for each column sum the counts to get the total
     set small to 1 if total = 0 otherwise 1/total
     set column total to total + small*char_set_size
     for each character type
        set matrix to counts + small
        p = matrix/total
        p = log ( p / 0.25 )
        matrix = p
     set unknown char (matrix) to mean for the column

Aligned sequences file format

name sequence comments

The file containing the aligned sequences should consist entirely of records containing data. Each record should contain a name, followed by the sequence, followed by arbitrary comments. Each record must be less that 2048 characters. At present make_weights is set to handle up to 10,000 records. Within a record fields (other than within the comments section) are separated by spaces. It is assumed that the sequences are aligned and do not contain leading spaces. For example, the last but 1 record below is not aligned in the file, but will be aligned after parsing.

AB002455  ctgacagaaggtgccagggt 1
AB002456  ccctggctgggtgagtatct 1
AB002456  tttgctccaggtagacactg 2
HSE27     atgtttgagggtgagggccc 1
AB002460  atccccaaaggtgccacagc 1 unusual
AB002461    cagggcccaggtaagggcgg 1
AB003312  aatgctcaaggtacagagac 1

A weight matrix file (as shown below) consists of a single record title (here test matrix), a record containing the motif length (here 11), the "mark position" (here 5), and the minimum and maximum scores (here 0.0 and 10.0). The "mark position" is an offset which is added to the position of any matches reported by the search routine in spin. The next two records are ignored by the programs. The first gives the matrix column positions, and the next the total counts in each column. The final records (4 for DNA weight matrices) give the counts for each character type at each position in the motif. These counts are converted into weights that are used during the searches. Any position in a sequence which scores at least as high as the minimum score (here 0.0) is reported as a match, and if the results are plotted they are scaled to fit the range defined by the minimum and maximum scores (here 0.0 and 10.0).

test matrix
11 5 0.0 10.0
P     0     1     2     3     4     5     6     7     8     9    10
n  8067  8067  8069  8067  8069  8069  8069  8069  8069  8069  8068
a  2572  4755   700    61    73  3759  5667   542  1236  2082  1624
c  3137  1109   301    33    89   260   671   518  1282  1803  2379
g  1515  1146  6343  7897   103  3759  1060  6502  1821  2879  2098
t   845  1059   725    77  7803   288   670   506  3728  1303  1967

The maximum number of columns in a record is 20. Longer motifs will have weight matrix files with sufficient blocks of 20 columns. For example the one shown below has 22 positions and so a second block has been started.

22 0 0.0 3.0
P  0  1  2  3  4  5  6  7  8  9 10 11 12 13 14 15 16 17 18 19
n  4  4  4  4  4  4  4  4  4  4  4  4  4  4  4  4  4  4  4  4
a  2  2  2  2  2  2  2  2  2  0  0  0  2  2  2  2  2  2  2  2
c  1  1  1  1  1  1  1  1  1  0  0  0  1  1  1  1  1  1  1  1
g  0  0  0  0  0  0  0  0  1  4  4  3  0  0  0  0  0  0  0  0
t  1  1  1  1  1  1  1  1  0  0  0  1  1  1  1  1  1  1  1  1
P 20 21
n  4  4
a  2  2
c  1  1
g  0  0
t  1  1


Show the version number of the program.
Set the mark position. When matches are found using the weight matrix offset m is added to the reported match position.
Set the minimum score. When the weight matrix is used to search a new sequence all positions which reach this score are reported as a match.
Set the maximum score. When the weight matrix is used to search a new sequence, matches are plotted using this value as the maximum.
Apply an input weight matrix to the set of aligned motifs. Write the scores for each motif on the screen, but do not create a new weight matrix file.
The file name for the weight matrix created.


Usage: make_weights [options] input_file
Where options are:
    [-w input weights filename]      [-o output filename]
    [-c min score]                   [-C max score]
    [-m mark position]               [-v version]


See section Motif search.

first previous next last contents
This page is maintained by staden-package. Last generated on 22 October 2002.